Wednesday, December 31, 2008
Monday, December 22, 2008
Sunday, December 21, 2008
Wednesday, December 17, 2008
Tuesday, December 16, 2008
BUFFALO POX IN INDIA
Rev. sci. tech. Off. int. Epiz., 2006, 25 (3), 981-987
An outbreak of buffalopox
in buffalo ( Bubalus bubalis) dairy
herds in Aurangabad, India
R.K. Singh (1, 6), M. Hosamani (1), V. Balamurugan (1),
C.C. Satheesh (1), K.R. Shingal (2), S.B. Tatwarti (3), R.G. Bambal (3),
V. Ramteke (4) & Mahendra Pal Yadav (5)
(1) Division of Virology, Indian Veterinary Research Institute, Mukteswar, Nainital District,
Uttaranchal-263 138, India
(2) Animal Husbandry, Disease Investigation Section, Aundh, Pune 411007, India
(3) Disease Investigation Section, Aundh, Pune 411007, India
(4) Animal Husbandry, Government of Maharashtra, Pune 411007, India
(5) Indian Veterinary Research Institute, Izatnagar-UP-243 122, India
(6) Author for correspondence: email: rk_singh@email.com
Submitted for publication: 6 September 2005
Accepted for publication: 18 September 2006
Summary
An outbreak of buffalopox in domestic buffaloes, with high morbidity and
significant production loss, was recorded in the Aurangabad district of
Maharashtra State in India in November 2003. The disease was also associated
with several cases of human infection, particularly in milkers working with the
affected herds. Pox lesions were observed on the udder and teats of the majority
of the affected animals, while a few animals exhibited lesions on the
hindquarters, indicating possible generalised infection. A significant reduction in
milk yield was recorded following the outbreak. Milkers developed pox-like
lesions on the skin of the hands, forearms and forehead accompanied by fever
for three days, axillary lymphadenopathy and general malaise. Investigation of
the disease outbreak by virus isolation in Vero cell cultures and detection of viral
nucleotide sequences by polymerase chain reaction (PCR) confirmed the
aetiology of the disease.
Keywords
Buffalopox virus – Indian Buffalo – Polymerase chain reaction – Zoonosis.
Introduction
Buffalopox is an important zoonosis of domestic buffaloes
(Bubalus bubalis) associated with high morbidity and
productivity losses. Disease outbreaks often lead to
considerable reduction in the milk yield of affected dairy
herds in addition to a reduction in the working capacity of
infected animals. It has been estimated that production of
buffalo milk in the Asia-Pacific region exceeds 45 million
tons annually, of which 30 million originate from India (5).
Thus, the impact of this disease on the dairy industry and
economy in the region is highly significant. Buffalopox is
also recognised as an important zoonotic infection (9).
People born after 1977 are potentially susceptible to
infection with buffalopox virus, a close variant of vaccinia
virus (8, 16), because smallpox vaccination ceased
worldwide in 1980.
Buffalopox is prevalent throughout the major buffalorearing
areas of the world, and outbreaks have been
reported in many countries including Indonesia, Egypt and
Pakistan (12). The disease has been recorded since 1934 in
different parts of India (2, 3, 7, 11, 14, 17, 19) and in the
last decade outbreaks of buffalopox have been reported
from many states including Uttar Pradesh, Rajasthan,
Andhra Pradesh, Gujarat and Karnataka (unpublished
data). The disease is caused by buffalopox virus (BPXV), a
prototype member of the Orthopoxvirus (OPV) genus in the
family Poxviridae. In this paper, the authors report an
outbreak of buffalopox in dairy herds on the outskirts of
Aurangabad which caused high morbidity and production
losses in the affected herds and also zoonotic infections in
animal handlers and milkers.
Disease outbreak
and clinical picture
The outbreak of buffalopox occurred in November
2003 on the outskirts of the Aurangabad district of
Maharashtra in India. The outbreak occurred in ten herds
containing buffaloes of mixed ages and of predominantly
the Jafarabadi breed and the Jafarabadi Surti crossbreed
of domestic buffalo. The farms were individually owned
with a total population of animals at risk of approximately
400. The overall morbidity reached 45% (a total of 180 of
the 400 buffaloes). Approximately 80% of the affected
buffaloes (which were aged between 6 and 12 years) were
Jafarabadi and Jafarabadi Surti dairy animals. The exact
number of buffalo bulls affected in the outbreak could not
be ascertained. However, two buffalo bulls intended for
breeding were found to be mildly affected in one of
the herds under investigation; the lesions were confined to
the hindquarters in these cases.
Clinical signs, such as lesions on the udder, teats and
hindquarters of the affected animals, were suggestive of
pox infection (Fig. 1). Characteristic circumscribed
ulcerated lesions with raised edges were observed, which
were painful on palpation. About 40% to 50% of the
affected animals showed mastitis and reduced milk yield,
mainly due to secondary bacterial infections. However,
four cases of mastitis and stricture of the teat canal directly
attributable to pox lesions were observed and permanent
loss of milk production as a consequence of mastitis was
reported in one case.
The exact source of the infection could not be ascertained.
However animal trade between villages (Dhulia and
Chauvi Bazar) was evident from the history, and this may
have contributed to the spread of the infection. The
outbreak started a month before the survey began, and
only three to four herds showed fresh clinical cases of
disease at the time of investigation.
Materials and methods
Collection and preparation of clinical materials
Scabs from pox lesions were collected primarily from the
thigh region, udder and teats of affected buffaloes. Blood
and milk samples were also collected from affected
animals, and from in-contact animals with no apparent
lesions, for serodiagnosis. The scab materials were ground
with a pestle in a mortar containing sterile sand. Phosphate
buffered saline (PBS) was added to prepare a 10% (w/v)
suspension. The samples were stored at –20°C until further
use, either for the extraction of DNA or for the isolation of
virus in cell culture.
Counterimmunoelectrophoresis
Preliminary screening of the scab and serum samples was
carried out using counterimmunoelectrophoresis (CIE)
Rev. sci. tech. Off. int. Epiz., 25 (3) 982
Fig. 1
Clinical lesions in buffaloes and milkers infected with buffalopox virus
Typical pox lesions found on the udder/teats of milk buffalo (Fig. 1a) and pre-inguinal region (Fig. 1b) of one of the affected buffalo bulls, which was
used for breeding purposes. The disease was also associated with human infections, with typical pox lesions noticed on the fingers (Fig. 1c) and
forearm (Fig. 1d) of milkers
a) b) c) d)
(18) with a reference antigen (BPXV-BP4) and its
hyperimmune serum (HIS). The BPXV antigen was derived
from infected Vero cells by clarification of the infected cell
culture fluid then concentrated by precipitating the viral
antigen with 8% (w/v) polyethylene glycol (PEG 6000).
Virus isolation
For virus isolation, scab samples were ground in sterile PBS
to make a 10% (w/v) suspension. The tissue triturate was
repeatedly frozen (at -80°C) and thawed 2 to 3 times and
then subjected to ultrasonication for 2 min at 30%
amplitude in pulse bursts of 9 s duration with 9 s intervals
to extrude virus particles from the cells and inhibit
bacterial and fungal contamination. Following clarification
at 6,000 g for 2 min in a microcentrifuge (Sigma 1-13,
Germany) 0.3 to 0.4 ml of the supernatant was treated
with gentamicin at a concentration of 40 µg/ml
(Gentamicin Injection, Cadilla Pharmaceuticals,
Ahmedabad, India) in Eagle’s Minimum Essential Medium
(EMEM) and inoculated onto Vero cell monolayers.
Ultrasonicated milk samples were similarly inoculated
onto Vero cell monolayers. Cells were incubated at 37°C
for one hour with intermittent shaking to allow adsorption
of virus. The virus inoculum was then decanted and the
infected cells were washed 4 to 5 times with serum-free
EMEM. Finally, the infected cells were fed with
maintenance medium containing 2% foetal calf serum and
incubated again at 37°C. Flasks were observed daily for the
appearance of cytopathic effect (CPE).
Viral deoxyribonucleic acid preparation
Total viral DNA was extracted either from scab material or
from infected cell culture fluid using the AuPreP™
DNA Extraction Kit (Life Technologies (India) Pvt Ltd,
New Delhi, India) following the manufacturer’s protocol.
DNA was extracted from a 200 µl initial volume of either
scab supernatant or infected cell culture fluid and finally
eluted in 50 µl of nuclease-free water for PCR.
Polymerase chain reaction
Viral DNA isolated from clinical material or cell culture
fluid was subjected to PCR for amplification of a fragment
of the A-type inclusion gene homologue (ATI) using the
following primer pair: CoPV03 (GGGATATCAAGGAAT
GCGA) and CoPV04 (TCCATATCAGCATTGCTTTC). The
full-length inclusion gene was amplified using the CoPV01
(TAAATGGAGGTCACGAAACT) and CoPV02 (TTCCCA
TTCACGTTCGCATG) primer pair (10, 15). For diagnostic
PCR, DNA samples prepared from BPXV-BP4-infected Vero
cells and uninfected Vero cells were also included in the
PCR reaction as positive and negative controls,
respectively. For amplification of the full-length gene,
camelpox virus DNA was used as the positive control,
while uninfected Vero cells were employed as the negative
control. The PCR products were analysed by 1% agarose
gel electrophoresis stained with ethidium bromide to
visualise amplified products.
Cloning and sequencing
The PCR products were gel-eluted using a commercial kit
following the manufacturer’s protocol (Qiagen, Hilden,
Germany) and cloned into plasmid vector pTZ57R/T (MBI
Fermentas, Hanover, Maryland, USA). Recombinant
plasmids purified using the SV minipreps plasmid
purification system (Promega Corporation, Madison,
Wisconsin, USA) were screened for the verification of the
cloned insert by both PCR and restriction endonuclease
digestion. The nucleotide sequence of the cloned insert
was determined by the dideoxy chain termination method
using an automated DNA sequencer (ABI Prism 377,
Applied Biosystems, Foster City, California, USA). The
sequence similarity of the gene fragment of the inclusion
gene of BPXV to other OPV sequences available in the
GenBank database was determined using the Clustal W
program of the Lasergene 6.0 package (DNASTAR Inc.,
Madison, Wisconsin, USA).
Serum neutralisation test
Serum samples collected from both clinically affected and
in-contact animals were subjected to a serum
neutralisation test for detecting antibodies against BPXV
using standard procedures (1). The serum samples (in
duplicate rows) were diluted in Eagle’s maintenance
medium in a two-fold dilution series from 1:2 to 1:64 in
flat-bottomed 96-well tissue culture plates. The reference
(50 µl/well) BPXV-BP4 virus suspension with a titre of
100 TCID50 in 50 µl was added to each serum well and the
mixture was incubated for one hour at 37°C in a
humidified CO2 incubator. An aliquot of 50 µl of Vero cell
suspension (approximately 1.5 106/ml) was added to
each well and the plates incubated. Serum (positive and
negative control sera), virus and cell controls were
included in the procedure. The plates were observed for
CPE for 3 to 4 days. The highest dilution of serum
inhibiting the CPE of virus at the 50% endpoint was taken
as the neutralising titre of the serum sample.
Results and discussion
Buffalopox is a highly contagious viral disease affecting
primarily buffaloes, its natural host, and can often be
transmitted to in-contact humans. The disease is
economically significant through a reduction in milk
Rev. sci. tech. Off. int. Epiz., 25 (3) 983
production, impaired capacity to work and lowered meat
production in affected animals. Although the disease is
associated with almost no mortality in buffaloes, the
morbidity can be high (4, 7).
The disease occurs in epidemic form in India with several
outbreaks reported in recent years (7, 11, 17). As a result
of the cessation of smallpox vaccination of humans in
1980, cross-species infection with animal poxviruses such
as BPXV, which is closely related to vaccinia and variola
(smallpox) viruses, poses a significant public health risk.
Humans with the disease develop localised pox lesions on
the skin of the hands and/or forehead accompanied by
fever and regional lymphadenopathy.
The outbreak reported here occurred in buffalo herds
located in a small close-settled community. It was noted in
the history that most of these herds had recently acquired
at least one or more animals from the local markets in
the Dhulia or Satara districts, which are known to be
endemic for buffalopox. These introduced buffaloes were
the probable source of infection for the studied herds.
Disease was mostly noticed in dairy animals and the spread
of disease within a given herd was probably facilitated by
dairy personnel; each herd had a single milker. The owners
reported that a significant reduction in the milk yield of
affected animals occurred. Based on the data collected from
the farmers, a 38% to 69% reduction in milk yield was
recorded as a consequence of the outbreak, in addition to
the permanent reduction in milk yield that occurred in
some cases as a sequel to severe mastitis. The estimated
cost of the veterinary treatment of one animal was Rs.400
(just over US$ 8.5) per treatment, which corresponds to a
15% to 20% loss of income per month per animal during
the period of the outbreak. In milkers and other animal
handlers, multiple dermal lesions on the fingers and
forehead and solitary nodules on the forearm were typical
of pox infection (Fig. 1). Other clinical signs observed were
fever, which lasted about three days, lack of appetite,
enlarged axillary lymph nodes and general malaise.
Unfortunately, milkers were generally unwilling to provide
biopsies and serum samples for laboratory diagnosis to
confirm the disease and enable an estimate of the
prevalence of this zoonotic disease in the community to be
made. A number of earlier zoonotic cases of buffalopox
have also been reported in the literature (11, 13, 17,
19, 21).
Preliminary laboratory diagnosis of the disease in buffaloes
was carried out by CIE using HIS raised against the
reference BPXV-BP4 isolate (20). Details of the samples
collected and analysed by the various diagnostic tests are
given in Table I. Polymerase chain reaction using OPV
genus-specific ATI gene primers (CoPV03 and CoPV04)
resulted in amplification of a fragment of 552 base pairs
(bp), as expected (Fig. 2). Cloning and sequencing of the
ATI gene fragment amplicon was carried out to confirm the
fidelity of the PCR and sequence data were submitted to
the NCBI GenBank database (DQ190239). The current
BPXV isolate shared 99% sequence identity with vaccinia
virus (VV) WR (AY243312) and rabbitpox virus (RPV)
(AY484669), 97% with camelpox virus M96 (AF438165)
and camelpox virus CMS (AY009089), 95% with cowpox
virus GRI-90 (X94355) and 93% with cowpox virus BR
(AF482758). Sequence analysis of the partial inclusion
gene of BPXV (552 bp) revealed only 1% divergence from
VV and RPV, clearly indicating that BPXV is a variant strain
of VV. Buffalopox virus has previously been suggested to be
a variant of VV, based on its host range, clinical signs, and
biological and serological properties (7, 8, 16).
Rev. sci. tech. Off. int. Epiz., 25 (3) 984
Table I
Analysis of clinical samples collected from the outbreak of
buffalopox in Maharashtra, India, in 2003
Number of samples giving
Sample positive results in the different Serum
type diagnostic tests neutralisation
Counterimmuno- Polymerase Virus titre
electrophoresis chain reaction isolation
Scabs (6)* 3/6 4/6 1/1 –
Milk (10) ND 0/10 2/3 –
Serum (27) 2/6 – – 14 sera tested
with titres
ranging from 1:2 to 1:8
* Figures in parentheses indicate the total number of samples collected
ND: not done
Fig. 2
Ethidium bromide-stained agarose gel electrophoresis
of polymerase chain reaction products of partial gene
of buffalopox virus A-type inclusion gene homologue using
CoPV03 and CoPV04 primers
Lane M: 100 base pair (bp) DNA ladder
Lane 1: amplicon of 552 bp fragment from BPXV-BP4 isolate as positive
control
Lane 2: negative control
Lanes 3, 4: amplicon from DNA isolated from scab material and infected
cell culture fluid (passage 2 in Vero cells infected with milk samples of
BPXV), respectively
M 1 2 3 4
552 bp
kbp
3.0
0.5
0.2
Amplification of the full-length inclusion gene, using the
CoPV01 and CoPV02 primer pair, was carried out for
diagnosis and further genetic characterisation of the virus.
The latter PCR amplifies a 3.7 kilobase (kb) product from
cowpox virus (15), a 3.2 kb product from BPXV and a
2.8 kb product from camelpox samples (Fig. 3). The
authors’ attempts to amplify the viral nucleic acid
sequences from milk failed. This could possibly be due to
the presence of PCR inhibitory substances in the milk
samples.
Virus isolation was successfully carried out in Vero cells
using skin scab and milk samples collected from infected
buffaloes. Cytopathic changes began with cell rounding
and clumping on day 2 post-infection (pi), and progressed
to formation of micro-plaques on days 3 to 4 pi followed
by degeneration of cells and finally complete detachment
of the monolayer by day 4 to 5 pi in the initial passage.
Similar cytopathic changes were observed in Vero cells
infected with the reference isolate of BPXV-BP4. Vero cells
were demonstrated to be a suitable cell culture system for
primary isolation of the virus, as cytopathic changes were
appreciable as early as three days after infection of the
preformed monolayer. Virus was successfully isolated from
two milk samples collected from affected buffaloes.
However, it required two blind passages in Vero cells to
produce appreciable CPE.
Rev. sci. tech. Off. int. Epiz., 25 (3) 985
PCR using template DNA extracted from both scab
material and Vero cells infected with virus from milk
samples yielded the expected 552 bp product (Fig. 2). This
is probably the first report of isolation of virus from milk
samples collected from buffaloes with pox infection.
However, it is possible that the presence of the virus in the
milk samples was due to cross contamination from infected
teats during sampling. Regardless of the source of the virus,
milk can serve as a potential vehicle of infection for other
animals including suckling calves, and for milkers and
personnel handling the milk. The presence of capripox
virus in milk and other body fluids has been demonstrated
previously, as reviewed by Davies (6).
Serum samples collected from apparently infected and incontact
animals showed neutralising titres ranging from
1:2 to 1:8 using the BPXV-BP4 isolate in Vero cells. This
showed that the animals were in various stages of infection,
as the outbreak was noticed in the herds one month before
the incident was investigated. The outbreak reported here
was severe in terms of the extent of the morbidity (up to
50%) and reports of productivity loss by farmers.
In summary, this outbreak of buffalopox was confirmed by
virus isolation, serum neutralisation, PCR, and nucleic acid
sequencing. Given the zoonotic importance of buffalopox
infection and the high productivity losses in dairy herds,
outbreaks of the disease need to be carefully monitored.
Milkers, farmers and other livestock handlers should
receive education on control measures such as restriction
of movement of animals with lesions, basic hygiene
practices and within and between herd biosecurity. This
needs to be addressed to limit the spread and severity of
buffalopox outbreaks and thus reduce the economic and
public health impact of buffalopox on the community.
Acknowledgements
The authors thank the Director, Indian Veterinary Research
Institute, for providing the necessary facilities to carry out
this work. This work was funded by the Department of
Biotechnology of the Government of India.
Fig. 3
Polymerase chain reaction amplification of full length A-type
inclusion gene homologue of buffalopox and camelpox viruses
Lane M: 1 kilobase (kb) DNA ladder
Lane 1: amplicon corresponding to ~_ 3.2 kb from BPXV Aurangabad
2003 scab DNA
Lane 2: negative control showing no amplification
Lane 3: camelpox virus DNA used as positive control showing amplicon
of ~_ 2.8 kb
M 1 2 3
3.2 kbp
2.8 kbp
kbp
10.0
6.0
3.0
2.0
1.0
Rev. sci. tech. Off. int. Epiz., 25 (3) 986
Foyer de variole du buffle dans des élevages
de bufflonnes laitières ( Bubalus bubalis) à Aurangabad, Inde
R.K. Singh, M. Hosamani, V. Balamurugan, C.C. Satheesh, K.R. Shingal,
S.B. Tatwarti, R.G. Bambal, V. Ramteke & Mahendra Pal Yadav
Résumé
Un foyer de variole du buffle s’est déclaré dans le district d’Aurangabad de l’état
de Maharashtra en Inde, en novembre 2003, provoquant chez les buffles
domestiques un taux de morbidité élevé ainsi qu’une baisse importante de la
production. La maladie a également été associée à plusieurs cas d’infection
humaine, notamment chez les ouvriers de traite. Des éruptions cutanées
caractéristiques de la variole sur les mamelles et les pis ont été observées chez
la plupart des bufflonnes affectées, avec quelques cas de lésions sur le train
postérieur, signe d’une possible infection généralisée. Une réduction importante
de la production de lait a été constatée suite à l’infection. Les symptômes
constatés chez les ouvriers de traite étaient une éruption cutanée au niveau des
mains, des avant-bras et du front, un accès de fièvre pendant trois jours, une
lymphadénopathie axillaire et un malaise généralisé. L’étiologie de la maladie a
pu être confirmée par isolement du virus sur des cellules Vero et détection des
séquences nucléotidiques au moyen de la technique d’amplification en chaîne
par la polymérase.
Mots-clés
Amplification en chaîne par la polymérase – Buffle d’Asie – Virus de la variole du buffle
– Zoonose.
Brote de viruela del búfalo en ganados de búfalas
( Bubalus bubalis) lecheras de Aurangabad (India)
R.K. Singh, M. Hosamani, V. Balamurugan, C.C. Satheesh, K.R. Shingal,
S.B. Tatwarti, R.G. Bambal, V. Ramteke & Mahendra Pal Yadav
Resumen
En noviembre de 2003, en el distrito de Aurangabad del estado indio de
Maharashtra se notificó un brote de viruela en búfalos domésticos que causó
una elevada morbilidad e importantes pérdidas en la producción. Hubo asimismo
varios casos de infección humana, sobre todo entre los muñidores que
trabajaban con los rebaños afectados. En las ubres y tetillas de la mayoría de las
hembras afectadas se observaron lesiones variólicas, y unos pocos ejemplares
mostraban también lesiones en los cuartos traseros, hecho indicativo de una
posible infección generalizada. Tras el brote se observó una sustancial caída en
la producción de leche. Los muñidores presentaban lesiones parecidas a las
variólicas en la piel de manos, antebrazos y frente, acompañadas de fiebre
References
1. Bandyopadhyay S.K., Singh R.P. & Chandra U. (1999). –
Efficacy of the micro-method of the assessment of
neutralising antibodies following vaccination/infection with
rinderpest virus. Indian J. anim. Sci., 69 (2), 82-84.
2. Baxby D. & Hill B.J. (1971). – Characteristics of a new
poxvirus isolated from Indian buffaloes. Arch. ges.
Virusforsch., 35 (1), 70-79.
3. Chandra R., Singh I.P., Garg S.K. & Varshney K.C. (1986). –
Experimental pathogenesis of buffalopox virus in rabbits:
clinico-pathological studies. Acta virol., 30 (5), 390-396.
4. Chandra R., Garg S.K., Rana U.V.S & Rao V.D.P. (1986). –
Pox infection of buffaloes. Farm Animals, 2, 57-69.
5. Cockrill W.R. (1997). – Buffalo production holds promise.
In Dairy India, 5th Ed. Gupta R.P., New Delhi, India, 13.
6. Davies F.G. (1991). – Lumpy skin disease, an African
capripox virus disease of cattle. Br. vet. J., 147 (6), 489-503.
7. Dumbell K. & Richardson M. (1993). – Virological
investigations of specimens from buffaloes affected by
buffalopox in Maharashtra State, India between 1985 and
1987. Arch. Virol., 128 (3-4), 257-267.
8. Fenner F., Wittek R. & Dumbell K.R. (1989). – The orthopox
viruses. Academic Press Inc., Harcourt Brace Jovanovich,
New York.
9. Food and Agriculture Organization (FAO)/World Health
Organization (WHO) (1967). – Expert committee on
zoonoses: poxvirus infection. Third Report, WHO Technical
Report Series, Geneva.
10. Funahashi S., Sato T. & Shida H. (1988). – Cloning and
characterization of the gene encoding the major protein of the
A-type inclusion body of cowpox virus. J. gen. Virol., 69 (1),
35-47.
11. Kolhapure R.M., Deolankar R.P., Tupe C.D., Raut C.G.,
Basu A., Dama B.M., Pawar S.D., Joshi M.V., Padbidri V.S.,
Goverdhan M.K. & Banerjee K. (1997). – Investigation of
buffalopox outbreaks in Maharashtra State during 1992-
1996. Ind. J. med. Res., 106 (11), 441-446.
12. Lal S.M. & Singh I.P. (1977). – Buffalopox: a review. Trop.
anim. Hlth Prod., 9 (2), 107-112.
13. Maqsood M. (1958). – Generalised buffalopox. Vet. Rec.,
70, 321-322.
14. Mathew T. & Mathew Z. (1986). – Isolation, cultivation and
haemadsorption of buffalo pox virus on BHK-21 cell line
from Dhule Epidemic (Western India). Int. J. Zoonoses,
13 (1), 45-48.
15. Meyer H. & Rziha H.J. (1993). – Characterization of the gene
encoding the A-type inclusion protein of camelpox virus and
sequence comparison with other orthopoxviruses. J. gen.
Virol., 74, 1679-1684.
16. Murphy F.A., Gibbs E.P.J., Horzinek M.C. & Studdert M.J.
(1999). – Veterinary virology, 3rd Ed. Academic Press, San
Diego, USA.
17. Nedunchelliyan S., Reddy D.S. & Venkataraman K.S. (1992).
– Buffalo pox infection in man. Ind. J. public Hlth., 36 (2), 57.
18. Sharma B., Negi B.S., Pandey A.B., Bandyopadhyay S.K.,
Shankar H. & Yadav M.P. (1988). – Detection of goat pox
antigen and antibody by the CIE test. Trop. anim. Hlth Prod.,
20 (2), 109-113.
19. Sharma G.K. (1934). – An interesting outbreak of variola
vaccinia in Lahore. Miscellaneous Bulletin of Imperial Council of
Agricultural Research (selected articles), 8, 1-4.
20. Singh I.P. & Singh S.B. (1967). – Isolation and
characterization of the etiological agent of buffalopox. J. Res.
Ludhiana, 4, 440-448.
21. Wariyar K.C. (1937). – Variola in buffaloes. Indian vet. J.,
14, 169-170.
Rev. sci. tech. Off. int. Epiz., 25 (3) 987
durante tres días, linfadenopatía axilar y malestar general. El estudio del brote
infeccioso, por aislamiento del virus en cultivos de células Vero y posterior
determinación por reacción en cadena de la polimerasa de sus secuencias
nucleotídicas, permitió confirmar la etiología de la enfermedad.
Palabras clave
Búfalo indio – Reacción en cadena de la polimerasa – Virus de la viruela del búfalo –
Zoonosis.
An outbreak of buffalopox
in buffalo ( Bubalus bubalis) dairy
herds in Aurangabad, India
R.K. Singh (1, 6), M. Hosamani (1), V. Balamurugan (1),
C.C. Satheesh (1), K.R. Shingal (2), S.B. Tatwarti (3), R.G. Bambal (3),
V. Ramteke (4) & Mahendra Pal Yadav (5)
(1) Division of Virology, Indian Veterinary Research Institute, Mukteswar, Nainital District,
Uttaranchal-263 138, India
(2) Animal Husbandry, Disease Investigation Section, Aundh, Pune 411007, India
(3) Disease Investigation Section, Aundh, Pune 411007, India
(4) Animal Husbandry, Government of Maharashtra, Pune 411007, India
(5) Indian Veterinary Research Institute, Izatnagar-UP-243 122, India
(6) Author for correspondence: email: rk_singh@email.com
Submitted for publication: 6 September 2005
Accepted for publication: 18 September 2006
Summary
An outbreak of buffalopox in domestic buffaloes, with high morbidity and
significant production loss, was recorded in the Aurangabad district of
Maharashtra State in India in November 2003. The disease was also associated
with several cases of human infection, particularly in milkers working with the
affected herds. Pox lesions were observed on the udder and teats of the majority
of the affected animals, while a few animals exhibited lesions on the
hindquarters, indicating possible generalised infection. A significant reduction in
milk yield was recorded following the outbreak. Milkers developed pox-like
lesions on the skin of the hands, forearms and forehead accompanied by fever
for three days, axillary lymphadenopathy and general malaise. Investigation of
the disease outbreak by virus isolation in Vero cell cultures and detection of viral
nucleotide sequences by polymerase chain reaction (PCR) confirmed the
aetiology of the disease.
Keywords
Buffalopox virus – Indian Buffalo – Polymerase chain reaction – Zoonosis.
Introduction
Buffalopox is an important zoonosis of domestic buffaloes
(Bubalus bubalis) associated with high morbidity and
productivity losses. Disease outbreaks often lead to
considerable reduction in the milk yield of affected dairy
herds in addition to a reduction in the working capacity of
infected animals. It has been estimated that production of
buffalo milk in the Asia-Pacific region exceeds 45 million
tons annually, of which 30 million originate from India (5).
Thus, the impact of this disease on the dairy industry and
economy in the region is highly significant. Buffalopox is
also recognised as an important zoonotic infection (9).
People born after 1977 are potentially susceptible to
infection with buffalopox virus, a close variant of vaccinia
virus (8, 16), because smallpox vaccination ceased
worldwide in 1980.
Buffalopox is prevalent throughout the major buffalorearing
areas of the world, and outbreaks have been
reported in many countries including Indonesia, Egypt and
Pakistan (12). The disease has been recorded since 1934 in
different parts of India (2, 3, 7, 11, 14, 17, 19) and in the
last decade outbreaks of buffalopox have been reported
from many states including Uttar Pradesh, Rajasthan,
Andhra Pradesh, Gujarat and Karnataka (unpublished
data). The disease is caused by buffalopox virus (BPXV), a
prototype member of the Orthopoxvirus (OPV) genus in the
family Poxviridae. In this paper, the authors report an
outbreak of buffalopox in dairy herds on the outskirts of
Aurangabad which caused high morbidity and production
losses in the affected herds and also zoonotic infections in
animal handlers and milkers.
Disease outbreak
and clinical picture
The outbreak of buffalopox occurred in November
2003 on the outskirts of the Aurangabad district of
Maharashtra in India. The outbreak occurred in ten herds
containing buffaloes of mixed ages and of predominantly
the Jafarabadi breed and the Jafarabadi Surti crossbreed
of domestic buffalo. The farms were individually owned
with a total population of animals at risk of approximately
400. The overall morbidity reached 45% (a total of 180 of
the 400 buffaloes). Approximately 80% of the affected
buffaloes (which were aged between 6 and 12 years) were
Jafarabadi and Jafarabadi Surti dairy animals. The exact
number of buffalo bulls affected in the outbreak could not
be ascertained. However, two buffalo bulls intended for
breeding were found to be mildly affected in one of
the herds under investigation; the lesions were confined to
the hindquarters in these cases.
Clinical signs, such as lesions on the udder, teats and
hindquarters of the affected animals, were suggestive of
pox infection (Fig. 1). Characteristic circumscribed
ulcerated lesions with raised edges were observed, which
were painful on palpation. About 40% to 50% of the
affected animals showed mastitis and reduced milk yield,
mainly due to secondary bacterial infections. However,
four cases of mastitis and stricture of the teat canal directly
attributable to pox lesions were observed and permanent
loss of milk production as a consequence of mastitis was
reported in one case.
The exact source of the infection could not be ascertained.
However animal trade between villages (Dhulia and
Chauvi Bazar) was evident from the history, and this may
have contributed to the spread of the infection. The
outbreak started a month before the survey began, and
only three to four herds showed fresh clinical cases of
disease at the time of investigation.
Materials and methods
Collection and preparation of clinical materials
Scabs from pox lesions were collected primarily from the
thigh region, udder and teats of affected buffaloes. Blood
and milk samples were also collected from affected
animals, and from in-contact animals with no apparent
lesions, for serodiagnosis. The scab materials were ground
with a pestle in a mortar containing sterile sand. Phosphate
buffered saline (PBS) was added to prepare a 10% (w/v)
suspension. The samples were stored at –20°C until further
use, either for the extraction of DNA or for the isolation of
virus in cell culture.
Counterimmunoelectrophoresis
Preliminary screening of the scab and serum samples was
carried out using counterimmunoelectrophoresis (CIE)
Rev. sci. tech. Off. int. Epiz., 25 (3) 982
Fig. 1
Clinical lesions in buffaloes and milkers infected with buffalopox virus
Typical pox lesions found on the udder/teats of milk buffalo (Fig. 1a) and pre-inguinal region (Fig. 1b) of one of the affected buffalo bulls, which was
used for breeding purposes. The disease was also associated with human infections, with typical pox lesions noticed on the fingers (Fig. 1c) and
forearm (Fig. 1d) of milkers
a) b) c) d)
(18) with a reference antigen (BPXV-BP4) and its
hyperimmune serum (HIS). The BPXV antigen was derived
from infected Vero cells by clarification of the infected cell
culture fluid then concentrated by precipitating the viral
antigen with 8% (w/v) polyethylene glycol (PEG 6000).
Virus isolation
For virus isolation, scab samples were ground in sterile PBS
to make a 10% (w/v) suspension. The tissue triturate was
repeatedly frozen (at -80°C) and thawed 2 to 3 times and
then subjected to ultrasonication for 2 min at 30%
amplitude in pulse bursts of 9 s duration with 9 s intervals
to extrude virus particles from the cells and inhibit
bacterial and fungal contamination. Following clarification
at 6,000 g for 2 min in a microcentrifuge (Sigma 1-13,
Germany) 0.3 to 0.4 ml of the supernatant was treated
with gentamicin at a concentration of 40 µg/ml
(Gentamicin Injection, Cadilla Pharmaceuticals,
Ahmedabad, India) in Eagle’s Minimum Essential Medium
(EMEM) and inoculated onto Vero cell monolayers.
Ultrasonicated milk samples were similarly inoculated
onto Vero cell monolayers. Cells were incubated at 37°C
for one hour with intermittent shaking to allow adsorption
of virus. The virus inoculum was then decanted and the
infected cells were washed 4 to 5 times with serum-free
EMEM. Finally, the infected cells were fed with
maintenance medium containing 2% foetal calf serum and
incubated again at 37°C. Flasks were observed daily for the
appearance of cytopathic effect (CPE).
Viral deoxyribonucleic acid preparation
Total viral DNA was extracted either from scab material or
from infected cell culture fluid using the AuPreP™
DNA Extraction Kit (Life Technologies (India) Pvt Ltd,
New Delhi, India) following the manufacturer’s protocol.
DNA was extracted from a 200 µl initial volume of either
scab supernatant or infected cell culture fluid and finally
eluted in 50 µl of nuclease-free water for PCR.
Polymerase chain reaction
Viral DNA isolated from clinical material or cell culture
fluid was subjected to PCR for amplification of a fragment
of the A-type inclusion gene homologue (ATI) using the
following primer pair: CoPV03 (GGGATATCAAGGAAT
GCGA) and CoPV04 (TCCATATCAGCATTGCTTTC). The
full-length inclusion gene was amplified using the CoPV01
(TAAATGGAGGTCACGAAACT) and CoPV02 (TTCCCA
TTCACGTTCGCATG) primer pair (10, 15). For diagnostic
PCR, DNA samples prepared from BPXV-BP4-infected Vero
cells and uninfected Vero cells were also included in the
PCR reaction as positive and negative controls,
respectively. For amplification of the full-length gene,
camelpox virus DNA was used as the positive control,
while uninfected Vero cells were employed as the negative
control. The PCR products were analysed by 1% agarose
gel electrophoresis stained with ethidium bromide to
visualise amplified products.
Cloning and sequencing
The PCR products were gel-eluted using a commercial kit
following the manufacturer’s protocol (Qiagen, Hilden,
Germany) and cloned into plasmid vector pTZ57R/T (MBI
Fermentas, Hanover, Maryland, USA). Recombinant
plasmids purified using the SV minipreps plasmid
purification system (Promega Corporation, Madison,
Wisconsin, USA) were screened for the verification of the
cloned insert by both PCR and restriction endonuclease
digestion. The nucleotide sequence of the cloned insert
was determined by the dideoxy chain termination method
using an automated DNA sequencer (ABI Prism 377,
Applied Biosystems, Foster City, California, USA). The
sequence similarity of the gene fragment of the inclusion
gene of BPXV to other OPV sequences available in the
GenBank database was determined using the Clustal W
program of the Lasergene 6.0 package (DNASTAR Inc.,
Madison, Wisconsin, USA).
Serum neutralisation test
Serum samples collected from both clinically affected and
in-contact animals were subjected to a serum
neutralisation test for detecting antibodies against BPXV
using standard procedures (1). The serum samples (in
duplicate rows) were diluted in Eagle’s maintenance
medium in a two-fold dilution series from 1:2 to 1:64 in
flat-bottomed 96-well tissue culture plates. The reference
(50 µl/well) BPXV-BP4 virus suspension with a titre of
100 TCID50 in 50 µl was added to each serum well and the
mixture was incubated for one hour at 37°C in a
humidified CO2 incubator. An aliquot of 50 µl of Vero cell
suspension (approximately 1.5 106/ml) was added to
each well and the plates incubated. Serum (positive and
negative control sera), virus and cell controls were
included in the procedure. The plates were observed for
CPE for 3 to 4 days. The highest dilution of serum
inhibiting the CPE of virus at the 50% endpoint was taken
as the neutralising titre of the serum sample.
Results and discussion
Buffalopox is a highly contagious viral disease affecting
primarily buffaloes, its natural host, and can often be
transmitted to in-contact humans. The disease is
economically significant through a reduction in milk
Rev. sci. tech. Off. int. Epiz., 25 (3) 983
production, impaired capacity to work and lowered meat
production in affected animals. Although the disease is
associated with almost no mortality in buffaloes, the
morbidity can be high (4, 7).
The disease occurs in epidemic form in India with several
outbreaks reported in recent years (7, 11, 17). As a result
of the cessation of smallpox vaccination of humans in
1980, cross-species infection with animal poxviruses such
as BPXV, which is closely related to vaccinia and variola
(smallpox) viruses, poses a significant public health risk.
Humans with the disease develop localised pox lesions on
the skin of the hands and/or forehead accompanied by
fever and regional lymphadenopathy.
The outbreak reported here occurred in buffalo herds
located in a small close-settled community. It was noted in
the history that most of these herds had recently acquired
at least one or more animals from the local markets in
the Dhulia or Satara districts, which are known to be
endemic for buffalopox. These introduced buffaloes were
the probable source of infection for the studied herds.
Disease was mostly noticed in dairy animals and the spread
of disease within a given herd was probably facilitated by
dairy personnel; each herd had a single milker. The owners
reported that a significant reduction in the milk yield of
affected animals occurred. Based on the data collected from
the farmers, a 38% to 69% reduction in milk yield was
recorded as a consequence of the outbreak, in addition to
the permanent reduction in milk yield that occurred in
some cases as a sequel to severe mastitis. The estimated
cost of the veterinary treatment of one animal was Rs.400
(just over US$ 8.5) per treatment, which corresponds to a
15% to 20% loss of income per month per animal during
the period of the outbreak. In milkers and other animal
handlers, multiple dermal lesions on the fingers and
forehead and solitary nodules on the forearm were typical
of pox infection (Fig. 1). Other clinical signs observed were
fever, which lasted about three days, lack of appetite,
enlarged axillary lymph nodes and general malaise.
Unfortunately, milkers were generally unwilling to provide
biopsies and serum samples for laboratory diagnosis to
confirm the disease and enable an estimate of the
prevalence of this zoonotic disease in the community to be
made. A number of earlier zoonotic cases of buffalopox
have also been reported in the literature (11, 13, 17,
19, 21).
Preliminary laboratory diagnosis of the disease in buffaloes
was carried out by CIE using HIS raised against the
reference BPXV-BP4 isolate (20). Details of the samples
collected and analysed by the various diagnostic tests are
given in Table I. Polymerase chain reaction using OPV
genus-specific ATI gene primers (CoPV03 and CoPV04)
resulted in amplification of a fragment of 552 base pairs
(bp), as expected (Fig. 2). Cloning and sequencing of the
ATI gene fragment amplicon was carried out to confirm the
fidelity of the PCR and sequence data were submitted to
the NCBI GenBank database (DQ190239). The current
BPXV isolate shared 99% sequence identity with vaccinia
virus (VV) WR (AY243312) and rabbitpox virus (RPV)
(AY484669), 97% with camelpox virus M96 (AF438165)
and camelpox virus CMS (AY009089), 95% with cowpox
virus GRI-90 (X94355) and 93% with cowpox virus BR
(AF482758). Sequence analysis of the partial inclusion
gene of BPXV (552 bp) revealed only 1% divergence from
VV and RPV, clearly indicating that BPXV is a variant strain
of VV. Buffalopox virus has previously been suggested to be
a variant of VV, based on its host range, clinical signs, and
biological and serological properties (7, 8, 16).
Rev. sci. tech. Off. int. Epiz., 25 (3) 984
Table I
Analysis of clinical samples collected from the outbreak of
buffalopox in Maharashtra, India, in 2003
Number of samples giving
Sample positive results in the different Serum
type diagnostic tests neutralisation
Counterimmuno- Polymerase Virus titre
electrophoresis chain reaction isolation
Scabs (6)* 3/6 4/6 1/1 –
Milk (10) ND 0/10 2/3 –
Serum (27) 2/6 – – 14 sera tested
with titres
ranging from 1:2 to 1:8
* Figures in parentheses indicate the total number of samples collected
ND: not done
Fig. 2
Ethidium bromide-stained agarose gel electrophoresis
of polymerase chain reaction products of partial gene
of buffalopox virus A-type inclusion gene homologue using
CoPV03 and CoPV04 primers
Lane M: 100 base pair (bp) DNA ladder
Lane 1: amplicon of 552 bp fragment from BPXV-BP4 isolate as positive
control
Lane 2: negative control
Lanes 3, 4: amplicon from DNA isolated from scab material and infected
cell culture fluid (passage 2 in Vero cells infected with milk samples of
BPXV), respectively
M 1 2 3 4
552 bp
kbp
3.0
0.5
0.2
Amplification of the full-length inclusion gene, using the
CoPV01 and CoPV02 primer pair, was carried out for
diagnosis and further genetic characterisation of the virus.
The latter PCR amplifies a 3.7 kilobase (kb) product from
cowpox virus (15), a 3.2 kb product from BPXV and a
2.8 kb product from camelpox samples (Fig. 3). The
authors’ attempts to amplify the viral nucleic acid
sequences from milk failed. This could possibly be due to
the presence of PCR inhibitory substances in the milk
samples.
Virus isolation was successfully carried out in Vero cells
using skin scab and milk samples collected from infected
buffaloes. Cytopathic changes began with cell rounding
and clumping on day 2 post-infection (pi), and progressed
to formation of micro-plaques on days 3 to 4 pi followed
by degeneration of cells and finally complete detachment
of the monolayer by day 4 to 5 pi in the initial passage.
Similar cytopathic changes were observed in Vero cells
infected with the reference isolate of BPXV-BP4. Vero cells
were demonstrated to be a suitable cell culture system for
primary isolation of the virus, as cytopathic changes were
appreciable as early as three days after infection of the
preformed monolayer. Virus was successfully isolated from
two milk samples collected from affected buffaloes.
However, it required two blind passages in Vero cells to
produce appreciable CPE.
Rev. sci. tech. Off. int. Epiz., 25 (3) 985
PCR using template DNA extracted from both scab
material and Vero cells infected with virus from milk
samples yielded the expected 552 bp product (Fig. 2). This
is probably the first report of isolation of virus from milk
samples collected from buffaloes with pox infection.
However, it is possible that the presence of the virus in the
milk samples was due to cross contamination from infected
teats during sampling. Regardless of the source of the virus,
milk can serve as a potential vehicle of infection for other
animals including suckling calves, and for milkers and
personnel handling the milk. The presence of capripox
virus in milk and other body fluids has been demonstrated
previously, as reviewed by Davies (6).
Serum samples collected from apparently infected and incontact
animals showed neutralising titres ranging from
1:2 to 1:8 using the BPXV-BP4 isolate in Vero cells. This
showed that the animals were in various stages of infection,
as the outbreak was noticed in the herds one month before
the incident was investigated. The outbreak reported here
was severe in terms of the extent of the morbidity (up to
50%) and reports of productivity loss by farmers.
In summary, this outbreak of buffalopox was confirmed by
virus isolation, serum neutralisation, PCR, and nucleic acid
sequencing. Given the zoonotic importance of buffalopox
infection and the high productivity losses in dairy herds,
outbreaks of the disease need to be carefully monitored.
Milkers, farmers and other livestock handlers should
receive education on control measures such as restriction
of movement of animals with lesions, basic hygiene
practices and within and between herd biosecurity. This
needs to be addressed to limit the spread and severity of
buffalopox outbreaks and thus reduce the economic and
public health impact of buffalopox on the community.
Acknowledgements
The authors thank the Director, Indian Veterinary Research
Institute, for providing the necessary facilities to carry out
this work. This work was funded by the Department of
Biotechnology of the Government of India.
Fig. 3
Polymerase chain reaction amplification of full length A-type
inclusion gene homologue of buffalopox and camelpox viruses
Lane M: 1 kilobase (kb) DNA ladder
Lane 1: amplicon corresponding to ~_ 3.2 kb from BPXV Aurangabad
2003 scab DNA
Lane 2: negative control showing no amplification
Lane 3: camelpox virus DNA used as positive control showing amplicon
of ~_ 2.8 kb
M 1 2 3
3.2 kbp
2.8 kbp
kbp
10.0
6.0
3.0
2.0
1.0
Rev. sci. tech. Off. int. Epiz., 25 (3) 986
Foyer de variole du buffle dans des élevages
de bufflonnes laitières ( Bubalus bubalis) à Aurangabad, Inde
R.K. Singh, M. Hosamani, V. Balamurugan, C.C. Satheesh, K.R. Shingal,
S.B. Tatwarti, R.G. Bambal, V. Ramteke & Mahendra Pal Yadav
Résumé
Un foyer de variole du buffle s’est déclaré dans le district d’Aurangabad de l’état
de Maharashtra en Inde, en novembre 2003, provoquant chez les buffles
domestiques un taux de morbidité élevé ainsi qu’une baisse importante de la
production. La maladie a également été associée à plusieurs cas d’infection
humaine, notamment chez les ouvriers de traite. Des éruptions cutanées
caractéristiques de la variole sur les mamelles et les pis ont été observées chez
la plupart des bufflonnes affectées, avec quelques cas de lésions sur le train
postérieur, signe d’une possible infection généralisée. Une réduction importante
de la production de lait a été constatée suite à l’infection. Les symptômes
constatés chez les ouvriers de traite étaient une éruption cutanée au niveau des
mains, des avant-bras et du front, un accès de fièvre pendant trois jours, une
lymphadénopathie axillaire et un malaise généralisé. L’étiologie de la maladie a
pu être confirmée par isolement du virus sur des cellules Vero et détection des
séquences nucléotidiques au moyen de la technique d’amplification en chaîne
par la polymérase.
Mots-clés
Amplification en chaîne par la polymérase – Buffle d’Asie – Virus de la variole du buffle
– Zoonose.
Brote de viruela del búfalo en ganados de búfalas
( Bubalus bubalis) lecheras de Aurangabad (India)
R.K. Singh, M. Hosamani, V. Balamurugan, C.C. Satheesh, K.R. Shingal,
S.B. Tatwarti, R.G. Bambal, V. Ramteke & Mahendra Pal Yadav
Resumen
En noviembre de 2003, en el distrito de Aurangabad del estado indio de
Maharashtra se notificó un brote de viruela en búfalos domésticos que causó
una elevada morbilidad e importantes pérdidas en la producción. Hubo asimismo
varios casos de infección humana, sobre todo entre los muñidores que
trabajaban con los rebaños afectados. En las ubres y tetillas de la mayoría de las
hembras afectadas se observaron lesiones variólicas, y unos pocos ejemplares
mostraban también lesiones en los cuartos traseros, hecho indicativo de una
posible infección generalizada. Tras el brote se observó una sustancial caída en
la producción de leche. Los muñidores presentaban lesiones parecidas a las
variólicas en la piel de manos, antebrazos y frente, acompañadas de fiebre
References
1. Bandyopadhyay S.K., Singh R.P. & Chandra U. (1999). –
Efficacy of the micro-method of the assessment of
neutralising antibodies following vaccination/infection with
rinderpest virus. Indian J. anim. Sci., 69 (2), 82-84.
2. Baxby D. & Hill B.J. (1971). – Characteristics of a new
poxvirus isolated from Indian buffaloes. Arch. ges.
Virusforsch., 35 (1), 70-79.
3. Chandra R., Singh I.P., Garg S.K. & Varshney K.C. (1986). –
Experimental pathogenesis of buffalopox virus in rabbits:
clinico-pathological studies. Acta virol., 30 (5), 390-396.
4. Chandra R., Garg S.K., Rana U.V.S & Rao V.D.P. (1986). –
Pox infection of buffaloes. Farm Animals, 2, 57-69.
5. Cockrill W.R. (1997). – Buffalo production holds promise.
In Dairy India, 5th Ed. Gupta R.P., New Delhi, India, 13.
6. Davies F.G. (1991). – Lumpy skin disease, an African
capripox virus disease of cattle. Br. vet. J., 147 (6), 489-503.
7. Dumbell K. & Richardson M. (1993). – Virological
investigations of specimens from buffaloes affected by
buffalopox in Maharashtra State, India between 1985 and
1987. Arch. Virol., 128 (3-4), 257-267.
8. Fenner F., Wittek R. & Dumbell K.R. (1989). – The orthopox
viruses. Academic Press Inc., Harcourt Brace Jovanovich,
New York.
9. Food and Agriculture Organization (FAO)/World Health
Organization (WHO) (1967). – Expert committee on
zoonoses: poxvirus infection. Third Report, WHO Technical
Report Series, Geneva.
10. Funahashi S., Sato T. & Shida H. (1988). – Cloning and
characterization of the gene encoding the major protein of the
A-type inclusion body of cowpox virus. J. gen. Virol., 69 (1),
35-47.
11. Kolhapure R.M., Deolankar R.P., Tupe C.D., Raut C.G.,
Basu A., Dama B.M., Pawar S.D., Joshi M.V., Padbidri V.S.,
Goverdhan M.K. & Banerjee K. (1997). – Investigation of
buffalopox outbreaks in Maharashtra State during 1992-
1996. Ind. J. med. Res., 106 (11), 441-446.
12. Lal S.M. & Singh I.P. (1977). – Buffalopox: a review. Trop.
anim. Hlth Prod., 9 (2), 107-112.
13. Maqsood M. (1958). – Generalised buffalopox. Vet. Rec.,
70, 321-322.
14. Mathew T. & Mathew Z. (1986). – Isolation, cultivation and
haemadsorption of buffalo pox virus on BHK-21 cell line
from Dhule Epidemic (Western India). Int. J. Zoonoses,
13 (1), 45-48.
15. Meyer H. & Rziha H.J. (1993). – Characterization of the gene
encoding the A-type inclusion protein of camelpox virus and
sequence comparison with other orthopoxviruses. J. gen.
Virol., 74, 1679-1684.
16. Murphy F.A., Gibbs E.P.J., Horzinek M.C. & Studdert M.J.
(1999). – Veterinary virology, 3rd Ed. Academic Press, San
Diego, USA.
17. Nedunchelliyan S., Reddy D.S. & Venkataraman K.S. (1992).
– Buffalo pox infection in man. Ind. J. public Hlth., 36 (2), 57.
18. Sharma B., Negi B.S., Pandey A.B., Bandyopadhyay S.K.,
Shankar H. & Yadav M.P. (1988). – Detection of goat pox
antigen and antibody by the CIE test. Trop. anim. Hlth Prod.,
20 (2), 109-113.
19. Sharma G.K. (1934). – An interesting outbreak of variola
vaccinia in Lahore. Miscellaneous Bulletin of Imperial Council of
Agricultural Research (selected articles), 8, 1-4.
20. Singh I.P. & Singh S.B. (1967). – Isolation and
characterization of the etiological agent of buffalopox. J. Res.
Ludhiana, 4, 440-448.
21. Wariyar K.C. (1937). – Variola in buffaloes. Indian vet. J.,
14, 169-170.
Rev. sci. tech. Off. int. Epiz., 25 (3) 987
durante tres días, linfadenopatía axilar y malestar general. El estudio del brote
infeccioso, por aislamiento del virus en cultivos de células Vero y posterior
determinación por reacción en cadena de la polimerasa de sus secuencias
nucleotídicas, permitió confirmar la etiología de la enfermedad.
Palabras clave
Búfalo indio – Reacción en cadena de la polimerasa – Virus de la viruela del búfalo –
Zoonosis.
Tuesday, December 9, 2008
DR.K.R.SHINGAL BIO DATA
Bio- Data 1. Name. : Dr. Kunjilal Rupchand Shingal 2. Father's Name: Shri Rupchand Raysingh Shingal 3. Sex. : Male 4 Date of Birth: 28.05.1953 5. Nationality: Indian 6. Designation: Former Regional Joint Commissioner of Animal Husbandry, Latur Region, Latur (M.S.), India. 7. Address for correspondence: AKSHAY Nagar Phase-I, Wing "A" Flat No. 1 Vishalnagar, Pimple Nilakh Pune 411027 (M.S.) India. (R) (O) (Mob. +919823059489 / +918830602259, 8. Permanent Address: Same As above 9. E-mail Address: drkrshingal@gmail.com, drkrshingal@yahoo.com, Web site:-www.drkrshingal.blogspot.com, YouTube:- Dr.Kunjilal Shingal, Dr.Kunjilal Shingal 2, Twitter:- DrKrShingal, Instagram:- DrKrShingal, 10. Educational Qualification. Degree / Diploma Name of University Subjects Year of passing B.V.Sc & AH Parbhani Veterinary College M.A.U. Parbhani. (M.S.) Veterinary Sci. & Animal Husbandry 1982 M.V.Sc Bombay Veterinary College K.K.V. Dapoli. Dist- Ratnagiri.(M.S.) Microbiology 1996 N.D.B.P. Indian Veterinary Research Institute Izatnagar. (U.P.) Biological Production 1990-91 Certificate in Office Automation Yashwantrao Chavan Maharashtra Open University Nashik –22.. (M.S.) Certificate in Office Automation August-1999 10 Date of Appointment in field: - 14 / 03 / 1983 B.N. 11. Details of Postings: - 14/3/1983 to 30/9/1983 served as a Livestock Development Officer, with Government of Maharashtra in class. II category, (Gazetted Officer) Key village Unit - Shendla. Taluka - Mehaker, District- Buldhana, India. From 1/10/1983 to 27/3/1989 served as a Livestock Development Officer, with Government of Maharashtra in class. II category, (Gazetted Officer) at - Veterinary Dispensary, Grade- I, Banoti, Taluka- Soegaon, District, Aurangabad. India. From 28/3/1989 to 2/8/1989 served as a Livestock Development Officer, with Government of Maharashtra in class. II category, (Gazetted Officer) at Veterinary Dispensary. Grade I, Kannad, Taluka- Kannad, District, Aurangabad. India. From 3/9/1989 to 27/6/1989 served as ASSISTANT Director Animal Husbandry, with Government of Maharashtra in junior class. I category, (Gazetted Officer) at Regional Disease Investigation Laboratory, Chiplun, District - Ratnagiri, India. From 3/5/1991 to 1/8/1991 served as ASSISTANT Director Animal Husbandry, with Government of Maharashtra in junior class. I category, (Gazetted Officer) at Regional Disease Investigation Laboratory, Chiplun, District - Ratnagiri, India. From 8/8/1991 to 16/8/1993 served as ASSISTANT Director Animal Husbandry, with Government of Maharashtra in junior class. I category, (Gazetted Officer) at Institute of Veterinary Biological Products, Aundh, Pune, Maharashtra, India. From 12/10/1995 to 16/9/1997 served as an Assistant Director Animal Husbandry, with Government of Maharashtra in junior class. I category, (Gazetted Officer) at Institute of Veterinary Biological Products, Aundh, Pune, Maharashtra, India. From 17/9/1997 to 1/7/2000 served as a District Animal Husbandry Officer Z.P. Satara, with Government of Maharashtra in junior class .I category (Gazetted Officer) at Zilla Parishad Satara Maharashtra, India. From 2/7/2000 to 30/10/2000 served as an assistant Director Animal Husbandry, with Government of Maharashtra in Junior class - I category, (Gazetted Officer) at R.A.I.C., Tasgaon Dist- Sangli, Maharashtra, India. From 31/10/2000 to7/07/2004 B.N. date served as a Deputy Director of Animal Husbandry (Cell culture) Disease Investigation Section, Aundh, Pune-7.with Government of Maharashtra in senior class. I category, (Gazetted Officer) Disease Investigation Section, Aundh, Pune-7., Maharashtra, India. From 20/07/2004 B.N. to 21/04/2006 as a Dist.Deputy Commissioner of Animal Husbandry Dist. Pune-3 .with Government of Maharashtra in senior class. I category, (Gazetted Officer) Maharashtra, India. From 2/05/2006 to 19/06/2009 A.N. as a Dist Deputy commissioner of Animal Husbandry, Nandurbar. M.S. India. From 20/06/2009 to 29/07/2010 Deputy Commissioner of Animal Husbandry(Virology), I.V.B.P., Aundh, Pune-7(M.S.), INDIA. Add Charge Joint Commissioner of Animal Husbandry, I.V.B.P.Aundh, Pune-7 from 23.12.009 to 29.07.2010 From 31.07.2010 to 31.05.2011 as Regional Joint Commissioner of Animal Husbandry, Region Latur, Latur (M.S.), India. List of awards / appreciation letters (Year wise) 1. Appreciation letter from Commissioner. Of Animal Husbandry Pune-1. M.S regarding Successful organized 4th Animal conference of Indian Association for the advancement of Veterinary Research at Pune 22-23 Jan 1997.Dated - 9/09/1997. 2. Appreciation letter from Add. Director of A.H. Pune M.S. regarding Successful organized 4th Animal conference of Indian Associate ion for the advancement of Veterinary Research at Pune 22-23 Jan 1997.dated- 31/01/1997 3. Appreciation letter from Founder Secretary and President of IAAVR regarding Successful organized 4th Animal conference of Indian Association for the advisement of Veterinary Research at Pune 22-23 Jan 1997.Dated - 18/2/1997 4. Apperception letter from Joint Director of Animal Husbandry Bombay regarding 45th All India Livestock and poultry Show 23rd to 28th March 1997 at Oros Dist. Sindhudurg (M.S.) Cattle Show at Oros (M.S.) Year- 1997 5. Appreciation letter from Commissioner of Animal Husbandry. (M.S.) Pune- 1. Regarding 45th All India Cattle Show at Oros (M.S.) Year -1997. 6. Appreciation letter from President of Zilla Parishad Satara regarding 51 Regional Cattle & Poultry Show at Akola. Year -1999 7. Appreciation letter from president of Zilla Parishad Satara regarding Excellent Officer. Year-1997 - 1998 8. Appreciation letter from President of Zilla Parishad Satara regarding Excellent Officer. Year-1997- 1999. 9. Awards from Zilla Parishad Satara as Excellent officer year -1998-99 10. Appreciation letter from Joint Secretary of Animal Husbandry Government. Of Maharashtra as an Excellent officer in the year -1998-99 dated- 4/1/2001. 11. Appreciation letter from Superintendent A.I.T.C. Khadki Pune-3. Excellent lecture for refresher course Livestock Development Officer. July-1995 to Aug-1996 Dated - 9/9/1999 11 Appreciation letter from Prof. P.K. Uppal Technical Director Diagnostic Research Laboratory Pune. Year Jun-2001. 12. Indian Association for the Advancement of Veterinary Research Confers “IAAVR FIELD VETERINARIAN AWARD- 2002”.For outstanding contributions to Animal Husbandry Programmes in the benefit of field and contemporary society. The award received through hands of Hon’ble Dr.V.K.Taneja Commissioner of Animal Husbandry Government of India., New Delhi. The award carries RS.500/- cash, certificate and Mementos At Nagpur(M.S.) IX Annual conference of I.A.A.V.R. and National Symposium on “Concepts in sustainable livestock production & health in new millennium” and Indian Veterinary Congress February 4-5, 2002 Organized by Department of Veterinary Microbiology Nagpur (M.S.) Maharashtra Animal and Fishery sciences University, Nagpur 13. IAAVR confers Dr.K.R.Shingal, "Certificate of Appreciation Outstanding Contribution in the control programme of Bird flu & Associated field Assignments 2009." Participation in Extension activities 1. Radio talk on how to control mastitis Disease in Animal Cattle and buffaloes (1989.) 2. Posters published on scheme of Animal Husbandry Department 5000 posters for distribution (1997-2000). 3. T.V. Programme of Cattle Show Nagthana Dist- Satara. (1999). 4. T.V. Programme SCP scheme particular goat unit Medha Tq.Medha Dist. Satara.M.S. (1999) 5. T.V. Programme on self-employment scheme of Buffaloes at KochaleWadi and Nagthana Village (1999) 6. T.V. Programme on self-employment scheme of Cross breed Cow at Karad Dist- Satara.M.S. (1999) 7. T.V. Programme on mass training programme at.Udtare Tq.Wai Dist- Satara, M.S., India. (1999) 8. T.V. Programme Show best Animals at 51st All India (Regional) Livestock & Poultry show Akola 9th to 14th January 1999 (M.S.) 9. Radio talk on Bacterial & viral disease in cattle and Buffaloes (1999). 10 Information regarding various Bacterial & viral disease was given to field officers, internee, livestock supervisors and cattle and Buffaloes farmers (1991 -2001). 11. Active Participation in all India cattle show Oros (M.S.) 1997 12.Active Participation in Dist. Sangli cattle Show Tasgaon (M.S.) on 4th Nov. o 6th 2000 13. Radio talk on Rabies disease on 20.08.2003 14. T.V. Programme Rabies disease (2002). Recording 13.07.2002 15. T.V. Programme IBR disease (2003). Recording 19.06.2003, telecast 12/05/2004, 13/05/2004 16. T.V. Programme PPR Disease (2004).Recording 6.03.2004 telecast 12/05/2004, 1.01.2005 17. T.V. Programme EMU farming (2004). Recording 11.03.2004, 24/05/2004, 25/05/2005 Publications (List Year wise) 1. Studies on Cross - Immunity with newly isolated strain of duck spirochete K.R. Shingal, V.B. Kulkarni, A.B. Gadge, V.K. Limaye and A.A.Sherikar Indian Association of Veterinary Microbiologist Immunologists and Specialists in Infectious diseases (IAVMI) at Pune. XIV - Annual conference and National Symposium on "Recent Advances in Production and testing of Veterinary Biological 29-31st Jan (1994) 29. 2. Screening for Rinderpest antigens and antibodies using ELISA in buffalo calves. A.A.Sherikar, S.B.Majee, R.Rajeswari, C.A.Kate, D.V.Undegaonkar, K.R.Shingal, P.S.Khandale and M.D.Patil. (1994). 55 XV Annual conference of Indian Association of Microbiologists, Immunologists and specialist in Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994) 55., at Mumbai. 3. Foot and Mouth Disease outbreak in vaccinated animals on an organized Farm. K.R.Shingal M.D. Patil, P.S. Khandale, A.A.Sherikar and S.B.Majee. XV Annual conference of Indian Association of Microbiologists, Immunologists and specialist in Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods -Healthy man, December 27 - 29 (1994) 59., at Mumbai. 4. Screening for Foot and Mouth Disease using MCFT, ELISA and suckling mice inoculation techniques in cattle and Buffaloes. A.A.Sherikar, S.B.Majee, R. Rajeshwari, K.R.Shingal, C.A.Kate. D.V.Undegaonkar, P.S.Khandale & M.D.Patil. (1994), 60. 5. Incidence of Enterotoxaemia in cattle in Konkan region, Maharashtra, K.R.Shingal, S.S.Dadke. XV Annual conference of Indian Association of Microbiologists, Immunologists and specialist in Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994)70., at Mumbai 6 Isolation of Pasturella multocida from a breeding colony of laboratory mice. K.R.Shingal, P.S.Khandale, D.V.Undegaonkar, R.Rajeshwari, A.A.Sherikar., S.B. Majee, & D.D. Manjrakar. XV Annual conference of Indian Association of Microbiologists, Immunologists and specialist in Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994)71., at Mumbai 7 Use of Rose Bengal dyes instead of crystal violet in preparing Salmonella coloured antigen for Salmonella diagnosis. K.R.Shingal, A.W.Kulkarni, M.N.Paratkar and M.N.Shete. Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994)81, at Mumbai. 8 Maintenance of Borrelia anserina, Mathura strain (Spirochaetosis), Vaccine Strain in the four week aged birds. K.R.Shingal, A.W.Kulkarni, M.N.Paratkar and M.N.Shete Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994) 98, at Mumbai. 9. Indefinite shelf life of freeze-dried Bacillus anthracis strain 34F2 (AXV2) stored at - 22°C. K.R.Shingal, A.W.Kulkarni, M.N.Paratkar and M.N.Shete Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994) 103 at Mumbai. 10. Comparative Studies of laboratory test in diagnosis of brucellosis in cattle's and buffaloes K.R. Shingal, P.S.Khandale, M.D.Patil, D.V.Undegonkar, C.A.Kate, R. Rajeshwari, S.B. Majee, & A.A.Sherikar Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994) 69 at Mumbai. 12. .Maintenance of Spirochetes from duck in chicks K.R.Shingal, A.W.Kulkarni S.N.Suryawanshi, V.M.Bhuktar and P.S.Lonkar Compendium the Indian Society for Veterinary Medicine XIII Annual convention and National Symposium on current approach to the latent disease of animal and birds 7-9 April (1995) HPKV Palampur (H.P.) 13. Vaccinal stress due to R 2B vaccination in flock with heavy worm infestation K.R.Shingal xvi Annual conference of Indian Association of veterinary Microbiologists, Immunologists and specialist in infectious diseases of Animals and poultry employing molecular Biological techniques, 3rdto 5th October (1995) 27 at Indian Veterinary Research Institute Mukeshwar (U.P) 14. Isolation of Staphylococcus aureus from local Chetan pepsi K.R.Shingal, D.V. Undegaonkar, Kazit Wadia, Chitra xvi Annual conference of Indian Association of veterinary Microbiologists, Immunologists and specialist in infectious diseases of Animals and poultry employing molecular Biological techniques, 3rd - 5th October (1995), 42 at Indian Veterinary Research Institute Mukteshwar (U.P) 15. Urea poisoning due to careless handling - case report K.R.Shingal 2 National convention of Veterinary Pharmacology and Toxicology December 22, (1995)65 Bombay Veterinary College Parel Mumbai at Goregaon (East) Mumbai 65. 16. Antibiogram of Pasturella multocida isolated from a breeding colony of laboratory mice K.R.Shingal, D.V. Undegaonkar, Kaizat Wadia, P.S. Khandale, and A.A. Sherikar compendium xvii Annual conference of Indian Association of Veterinary Microbiologist Immunologists and specialists in infectious disease (IAVMI) and National symposium on Advancements in Immuodiagnosis and control of emerging and exotic diseases of livestock poultry and Fish 16th to 18th November 1996 Department of Bacteriology and Virology faculty of Bacteriology and Virology faculty of veterinary science O.U.A.T Bhubaneswar Orissa. 17. Hydrocephalus calf born from non-descripts cow- A case report. K.R.Shingal Abstracts January1997, 98 (1997), IAAVR 4th Annual conference 22nd -23rd January 1997 at IUCAA, Pune (M.S.) 18. Incidence of furious form of Rabies in Asu village of Maharashtra in cattle and Buffaloes Khandale P.S. Bagwan S.M., Shingal K.R.and Pattanshetty M.M Abstracts January (1997), 18. IAAVR 4th Annual conference 22rd -23rd January 1997 IUCAA Pune(M.S.) 19. Maintenance of Borrelia Anserina strains in poultry blood after addition of cryoprotective by deep freezing). Suryavanshi S. N., K.R. Shingal Kulkarni A.W., Shinde D.N., Paratkar & Vazarkar R.T Abstracts January (1997), 227 IAAVR 4th Annual conference 22rd -23rd January 1997 IUCAA Pune(M.S.) 20. Freeze drying of Salmonella pullorum for preparation of coloured antigen K.R.Shingal, Shinde D.N., Naik S.D., Wazarkar R.T. and Joshi S.S.Abstracts January (1997) 228 IAAVR 4th Annual conference 22rd -23rd January 1997 IUCAA Pune(M.S.) 21 .Effect of light regimen on eggs production in red ireland rhode layers. Borole S.M., Bhuktar V.M. and Shingal K.R. Abstracts January (1997), 233 IAAVR 4th Annual conference 22rd - 23rd January 1997 at IUCAA Pune(M.S.) 22 .Profile of inclusion body hepatitis in Maharashtra Borole S.M., Bhuktar V .M., Tawarthy S.B.Pande V.V. and Shingal K.R. Abstracts January (1997), 235 at IAAVR 4th Annual conference 22rd -23rd January 1997 IUCAA, Pune(M.S.) 23. Role of trible and rural woman in poultry development Maharashtra Borole S.M., Bhuktar V.M., and Shingal K.R. Abstracts January (1997), 238 at IAAVR 4th Annual conference 22rd -23rd January 1997 IUCAA Pune (M.S.) 24. Hypersensitivity to parental Iron Dextran in Buffalo Shingal K.R.J.Bombay Veterinary College (1998) 6(1) p.81 25. Hypersensitivity to parental Iron Dextran in Crossbreed jersey cow Shingal K.R. Veterinary Research Abstracts compendium Indian Veterinary Congress 18-19 Feb-(2000), 62 at Indian Veterinary Research Institute, Izatnagar (U.P.) 26. Hypersensitivity to parenteral Iron Dextron in Crossbreed HF Shingal K.R. IAAVR VIII Annual conference and National Symposium on animal health and production in new millennium and Indian Veterinary Congress 22-23 Feb-(2001)85 at PAU Ludhiana (Punjab) 27. An outbreak of Bluetongue in sheep in Maharashtra State K.R. Shingal, R.G.Bambal, R.V. Kulkarni and S.V. Puranik XIX Annual Convention of the Indian society for veterinary medicine and national symposium on current trends on diagnosis, Therapeutic approach and development of vaccine again disease of livestock and poultry (2001)9-11 April 2001. at R. S. Pura Jammu. 28. Status of Rabies Diagnosis in Maharashtra State. Shingal K.R., Gaharwar I.M., Bambal R.G., Kawade K.M., Ambhore T.N.and Deshmukh S.R. IX Annual conference of I.A.A.V.R. and National Symposium on “Concepts in sustainable livestock production & health in new millennium” and Indian Veterinary Congress February 4-5, 2002 Organized by Department of Veterinary Microbiology Nagpur (M.S.) Maharashtra Animal and Fishery sciences University, Nagpur. 29. Combined Vaccination of Cattle Against Foot and Mouth Disease, Haemorrhagic Septicemia and Black Quarter. Shingal K.R., Kilari S, Sawarkar S.D, and Singh S.N. IX Annual conference of I.A.A.V.R. and National Symposium on “Concepts in sustainable livestock production & Health in new millennium” and Indian Veterinary Congress February 4-5, 2002 Organized by Department of Veterinary Microbiology Nagpur (M.S.) Maharashtra Animal and Fishery sciences University, Nagpur. Publications of Books. 1. " Biotechnology in Animal Heath & Production for Economic Development in Asia in Respect of Global Scenario " editor Rishendra Verma, S. N. Singh, K.R. Shingal, 2. Souvenir and abstracts published in IVth IAAVR Annual Conference 22-23 Jan-1997, at Pune worked as editor 3. Souvenir Cattle Show Published 4- 5 Nov-2000. At Tasgaon, Dist- Sangli (M. S.} worked as editor. Popular articles 1. Precaution to be taken while handling & milking K.R.Shingal Shetkari - (July-1995), 35 2. Regarding Rabies disease information (2000) A.A.Sherikar, S.B.Majee, A.M.Das, R.M.Patil, K.R.Shingal Souvenir Cattle show Tasgaon District: Sangli Dated 4-6 Nov-2000. 3. Animal Husbandry economy of new millennium V.M.Bhuktar and K.R.Shingal Shewetkranti October-November-2001(Vol-IV) 4. Effects of pesticides V.M.Bhuktar and K.R.Shingal, Shewetkranti October-November- 2001 (Vol-IV) 5.Rabies Disease and their remedies. K.R.Shingal, Shetkari August- 2003 (Vol-III) page, 29 6.P.P.R. K.R.Shingal, V.V.Deshmukh, R.R.Farande Shewetkranti June-July- 2004 Shewetkranti June-July- 2004 7.I.B.R. Disease K.R.Shingal, V.V.Deshmukh, R.R.Farande Shewetkranti June-July- 2004 Shetkar 8.Well to EMU farming sou.Chitra Mehta, shri. B.Mehta, K.R.Shingal, Shewetkranti August - September- 2004 (Vol-III) page 11-14 9. Care of the calf I.M.Gahrwar, K.R.Shingal, V.M.Bhuktar Shewetkranti August -September- 2004 (Vol-III) page 23 10.EMU farming, Dr.K.R.Shingal, Shetkari May - 2005 (Vol-X11) page, 17 11. Success story poultry keeping Dr.K.Mugalikar, Dr.K.R.Shingal, Dr.P.L.Kuntewarpage Shewetkranti June –July-2005 (Vol.II)-21 Deputation in India or abroad for training. 1. Composite training at A.I.T.C. Akola form 12 /4/1983 to 9/5/1983 2. Work Shop- cum - Seminar of Veterinary Diagnostic Organized by the Division of Animal Science Extension Indian Veterinary Research Institute Izatnagar for 1/11/1989 to 8/11/1989. 3. Freeze dried Spirochete vaccine for 15 days at Institute of Veterinary Biological Products, (Year 1992) Mhow, and (M.P.) India. 4. Refresher course in goat farming form 12/1/1994 to 14/1/1994 at Bombay Veterinary College Mumbai. 5. Diagnosis of Mycoplasma in Livestock from 14-20 Feb.1996 at Wagholi BAIF Pune. 6. International Course on Advances in Vaccine Technologies and Veterinary Application March-4-9, 1997 at P.A.U. Ludhiana (India) 7. Veterinary Council of India Orientation training date 8/11/1997 at Pune. 8. Refresher Course for Agriculture and Animal Husbandry Officer from 12/10/1998 to 16/10/1998 at Yeshwantrao Chavan Academy of Development Administration, Pune. M.S. 9. Certificate in Office Automation completed the computer programme of 3 months duration, year- 1999. 10. "Special Component Plan” 21-25 Feb-2000 at Yeshwantrao Chavan Academy of Development Administration, Pune. M.S. 11. Training programme of orbi virus Diagnosis between 13th -17th Feb. 2001. Conducted by National Expert and OIE experts Dr. Philip Mellor and Chris Hamblin Pirbirght U.K. at RWITC. Pune. M.S. 12. Workshop on Disease Diagnostic Techniques 22-23 Feb-2001. PAU Ludhiana Veterinary College. 13. Short term training on “Diagnosis of Infectious Bovine Rhinotracheitis -Plan of work organized by center for Animal Diseases Research and Diagnosis (CADRAD) Indian Veterinary Research Institute for 17/8/2001 to 30/8/2001. 14. Workshop on Bluetongue disease 3-11-2001 M.A.U. Veterinary and Animal Sciences College, Parbhani. 15."Labortory Practices in Cell &Tissue culture" at NCCS, Pune-7 (M.S.) from December, 15th till December 31st, 2001 16.Workshop on “Genetic Improvement in Cattle and Buffalo” on 16th -17th 2005 Venue Yashwantro Chavan Academy of Development Administration, Raj Bhavan complex, Banner Road, Pune-7 (M.S.), organized by Bombay Veterinary College, Parel, Mumbai, MAFSU, Nagpur 17. 30. Yashda Training Information Date 19.09.2006 at Nandurbar. 18. “Training to Trainer’s of RRT for control of avian Influenza” on 6th & 7th October 2006, Organized by WRDDL, Pune at YASHDA, Pune (M.S.) 19.Goverment of Maharashtra World Bank Assisted Maharashtra Agricultural Competiveness project Launch workshop Date. 18th and 19th January 2011, Venue: Pune, M.S., India. 20. Regional Workshop on preparedness Control & Contament of Avian influenza (Bird flu). Date 18.03.2011, venue, Yashada, Pune, M.S. Attended, Participated, International Conference/Symposium International Symposium On Virus-Cell Interaction: Cellular and Molecular Responses held during 22-24 November, 1993 Organised by the Indian Veterinary Research Institute, Bangalore Campus and sponsored by the Department of Biotechnology, Government of India, and Swiss Development Cooperation, Swiss Federal Government. 2. Diagnosis of Mycoplasma in Livestock from 14-20 Feb.1996 at Wagholi BAIF Pune. 3. XX World’s Poultry congress held from 2nd to 5th September 1996 at Taj Palace Intercontinental convention center, New Delhi, India, 4. International Course on Advances in Vaccine Technologies and Veterinary Application March-4-9 1997 at P.A.U. Ludhiana (India) 5. International Conference on Ethno Veterinary Medicine Alternatives for Livestock Development held in Pune India 4-6. Nov.1997. Organized by BAIF Development Research Foundation MDMTC, Pune, Indi6.Seminer/Training Programme of Orbi virus Diagnosis between 13th -17th Feb. 2001. Conducted by National Expert and OIE experts Dr. Philip Mellor and Chris Hamblin Pirbirght U.K. at RWITC. Pune. M.S. 7. South Asian Regional Poultry Conference held in Pune, India, September 24-26, 2001. Attended, Participated National conference/Symposium 1. Indian Association of Veterinary Microbiologist Immunologists and Specialists in Infectious diseases (IAVMI) at Pune.XIV- Annual conference and National Symposium on “Recent Advances in Production and testing of Veterinary Biological 29-31st Jan.(1994) Venue, NCL, Pune-7 2. XV Annual conference of Indian Association of Microbiologists, Immunologists and specialist in Infectious disease (IAVMI) and National symposium on Healthy animals - Safe Foods - Healthy man, December 27 - 29 (1994) 55., at Parel, Mumbai. 3 The Indian Society for Veterinary Medicine XIII Annual convention and National Symposium on current approach to the latent disease of animal and birds 7-9 April (1995) HPKV, Palampur, India. 4. XVI Annual conference of Indian Association of Veterinary Microbiologists, Immunologists and Specialist in Infectious diseases of Animals and poultry employing molecular Biological techniques, 3rd to 5th October (1995) 27 at Indian Veterinary Research Institute Mukeshwar, (U.P), India. 5. II National Convention of Veterinary Pharmacology and Toxicology Department of Pharmacology & Toxicology, Bombay Veterinary College Konkan Krishi Vidyapeeth, Parel, Bombay 400012, India. 22, (1995) Mumbai at Goregaon (East) Mumbai 65. 6. XIV Annual Conference of Society of Toxicology, India Toxicology Department of Pharmacology & Toxicology, Bombay Veterinary College Konkan Krishi Vidyapeeth, Parel, Bombay 400012, India.20-21, 1995. Mumbai at Goregaon (East) Mumbai 65. 7. XVII Annual conference of Indian Association of Veterinary Microbiologist Immunologists and specialists in infectious disease (IAVMI) and National symposium on Advancements in Immuodiagnosis and control of emerging and exotic diseases of livestock poultry and Fish poultry and Fish 16th to 18th November 1996 Department of Bacteriology and Virology faculty of Bacteriology and Virology faculty of Veterinary science O.U.A.T Bhubaneswar, Orissa., India. 8.III Annual conference of IAAVR &National Symposium On Prospects of Livestock and Development in 21st Century February 23 –24, 1996 at Indian Veterinary Research Institute, Izatnagar (U.P.) Jointly organized by IAAVR& Central avian research Institute (CARI), Iztnagar (U.P.), India. 9.Indian Society for Veterinary Surgery Nashik chapter 5th Annual technical seminar of I.S.V.S. Nashik chapter on 23rd –24th November 1996 at Sonai, tal. Newasa Dist. Ahmednagar, M.S., India. 10. National symposium of “Biotechnology in animal health and production for economic development in Asia in respect of Global Scenario” IAAVR 4th Annual Conference 22nd -23rd January 1997 at IUCAA, Pune (M.S.), India. 11.One- Day Symposium on Pollution Control Technology 23rd February, 1197 Organized by Department of Microbiology ME.S.’S Abasaheb Garware College, Karve Road, Pune-411004.(M.S.), India. 12.Recent Advances in Technical and Management Aspects in Poultry Industry April 28th –29th 1997 Meet for N.C.D.C, aided Poultry co-operative Societies in Maharashtra Organised by Department of Animal Husbandry, Maharashtra State Disease Investigation Section, Aundh Pune-411007 CDAC Hall, Pune Univ. Campus, M.S., India. 13. The Indian Society for Veterinary Medicine XIII Annual convention and National Symposium on Dec.22-24 1998 at Nagpur (M.S.), India. 14. 5th Annual Conference of IAAVR and National Symposium at Indore on 22-23, Feb. 1998 at Indore, (M.P.), India. 15.51st All India (Regional) Livestock & Poultry Show Akola 9th to14th January 1999 MAHARASHTRA Organised by: - Department of Animal husbandry, Govt. of Maharashtra and Govt. of India. 16.All India livestock & Poultry Show jaipur 1 to 10 th January 2000 organized by Department of Animal Husbandry, Govt of Rajasthan, Govt of India 17.Veterinary Research Abstracts compendium Indian Veterinary Congress 18-19 Feb-(2000) at Indian Veterinary Research Institute, Izatnagar (U.P.) 18.National Symposium on “Current concepts in Animal and Poultry diseases-New Millennium Approach” and xvii Annual conference of Veterinary Pathologists 11th to 13th December, 2000 A kola (India) Organized by Department of Veterinary Pathology, Faculty of Veterinary science, Post graduate Institute, Dr Panjabrao Deshmukh Krishi Vidyapeeth, Akola 444104(M.S.), India. 19. VIII Annual Conference of IAAVR and National Symposium on “Animal Health and Production in New millennium” and Indian Veterinary Congress February 22-23, 2001 Organized by Department of Veterinary Pharmacology and Toxicology Punjab Agricultural University, Ludhiana-141004. (Punjab), India. 20.Association for prevention & control of Rabies in India-APCRI.3rd National l conference on Rabies at Department of Community Medicine, Government Medical College, Amritsar. 6-7 July 2001.Amritsar. (Punjab), India. 21. IX Annual conference of I.A.A.V.R. and National Symposium on “Concepts in sustainable livestock Production & Health in New Millennium” and Indian Veterinary Congress February 4-5, 2002 Organized by Department of Veterinary Microbiology Nagpur (M.S.) Maharashtra Animal and Fishery Sciences University, Nagpur. M.S. India. 22. Indian Society for Veterinary Surgery Nashik Chapter VIIth Annual Technical Seminar of I.S.V.S. Nashik chapter on 9 & 10Feb.2002 at Mahatma Phule Krishi Vidyapeeth, Rahuri Dist. Ahmednagar, M.S., India. 23.Roving Seminar on IPR in Biotechnology 30th September, 2002 Organised by National centre for Cell science, Pune & Department of Biotechnology, New Delhi., India. 24. India Association of Equine Practitioners “Continuing Education short Course 03 November 2003 to 07 November 2003 Organized by RWTC Pune (M.S.), India. 25. “A Technical Seminar” On the occasion of “World Veterinary Day” Organized by Maharashtra Rajya Padvidhar Pashuvaidyak Sanghtna, Aurangabad (M.S.) Venue:- Hotel President park, Near CIDCO Bus stand, Jalna Road, Aurangabad, M.S., India. Date 28 .04. 2004 26. “RDDL Meeting on 24th to 26th 2004 at Bangalore, Karnataka, India. 27. National Seminar Livestock Policy Maharashtra State on 27th & 28th October, 2004 Venue: NITIE, POWAI, MUMBAI, M.S., India. 28. National Symposium on Newer concepts and challenges in veterinary science & Animal Husbandry XII Annual conference of IAAVR- 2005 and 5th Indian Veterinary congress December 31st 20004 1st & 2005 at College of Veterinary & Animal Science (Rajasthan Agricultural University), Bikaner- 334001 (Raj.) 29. BIRD FLU Exp. At Navapur on Date 21/02/2006 to 5/03/2006 30. All MAHARASHTRA Livestock & Poultry Show KAGAL Dist.Kholapur (M.S.) 17th to 19th April 2005 Organised by: - Department of Animal husbandry, of Maharashtra and Kagal Ghorav samiti 31.YASHADA Training Information Date 19.09.2006 at Nandurbar.M.S., India. 32. “Training to Trainer’s of RRT for control of avian Influenza” on 6th & 7th October 2006, Organized by WRDDL, Pune at YASHDA, Pune (M.S.) 33.XVII th animal Conference of IAAVR and National Symposium on "Newer challenge in Veterinary Research & Education Vis- a Vis Safe Animal, food & Human Health" Held during March 11-12, 2010 organized by college of Veterinary Science & Animal Husbandry M.P., Jabalpur, M.P., India. 34.IX Annual Conference of India Association of Veterinary Public Health Specialists National Symposium on "Veterinary Public Health: New Horizon for Integrating the Animal Production, food Safety and Human Health" (28 th & 29 th January, 2011) organized by Department of Veterinary Public Health, Bombay Veterinary College, Parel, Mumbai 400012, M.S., India. 34. XI Vth Technical Seminar India Society for Veterinary Surgery Nashik Chapter 5 th -6 th February 2011 Mahatma Phule Krishi Vidyapeeth Rahuri Dist. Ahmednagar. M.S., India.
35. The National conference 'YUGANTAR".' The Rousing Challenge of Management Systems and Practices in 21st Century< with Alard Institute of Management Science on 29th & 30th Sept.2011 at VITS, Hotel, Balewadi, Pune, M.S., India.
Self-appraisal I Dr. K.R. Shingal presently working as enquiry officer, Government of Maharashtra State since from 16-Feb-2016 till today. Technical consultant Bio-Med company private Ltd, Ghaziabad, U.P., India since from March 2014 till today. Formerly worked as Regional Joint Commissioner of Animal Husbandry, Latur. Government of Maharashtra since 31-07-2010. I graduated from Parbhani Veterinary College and post-graduation in M.V.Sc Microbiology From Bombay Veterinary College and another post-graduation diploma N.D.B.P. from I.V.R.I. Izatnagar (U.P.) I hail from the farmer family in Brahamni taluka Kannad Dist. Aurangabad, Maharashtra I obtained awards and also so many appreciation letters from Join Secretary ADF Govt Maharashtra of President Zilla Parished Satara (M.S) And Commissioner of Animal Husbandry, Additional Director of Animal Husbandry Maharashtra state. I published twenty-nine papers and one book by the title "Biotechnology in animal health and production of economic development in Asia in respect of Global scenario" and four popular articles in Marathi journals. I have under gone (three international and Twelve national) technical and administrative training I have given number of lectures to farmer regarding technical as well as animal husbandry Scheme I have given lectures and training to veterinary graduates at I.V.B.P. and Disease Investigation section Aundh Pune from 1991 to date . I was an external examiner for B.V.Sc & A.H. for K.N.P.College of Veterinary Science .Shirval Satara. When I was Joint organizing secretary. I have organized fourth annual conference of I.A.A.V.R. on 22nd -23rd JAN.1997 AT Pune. I worked as an editor to the souvenir and abstracts as IAAVR in January 1997 as well as rapoteur, Chairman and editor to the souvenir of cattle show at Tasgaon year -2000. I have also participated in T.V. and Radio programme during 1997 to 2006. I am life member of numerous associations. I have made seventy persons as life member to IAAVR Association. I was an executive member of Indian Association of Veterinary Microbiologist Immunologists and Specialists in Infectious diseases from 1996 to 1999. And also executive member of Indian Association for the Advancement of Veterinary Research from 1998 till date. I was Joint secretary to Bombay Veterinary College Alumni Association from 1994 to 1999. I have participated 43 and 7 International seminars and 7 Workshops pertaining to the Animal Husbandry DECLARATION I hereby declare that the that the information furnished above is true, complete & correct best to the my knowledge & belief. I understand that in the event of any candidature appointment shall be liable to cancellation termination without notice or any compensation in lieu thereof. Date.04.07.2018 Dr.K.R.Shingal Pune-27
Labels:
Dr.K.R.Shingal Ex. R.J.C.A.H.,
India.,
Latur,
M.S.
Monday, December 8, 2008
WEB SITES
Advance Science & Technology in Animal Husbandry: WEB SITE
http://www.elitmus.com
http://www.linkedin.com
www.nottingham.ac.uk
www.incometaxindiaefiling.gov.in
www.incometaxindiaefiling.gov.in
http://www.ammimah.org/
http://www.ncdc.nic.in/
http://www.nafed.india.com/
http://www.nddb.org/
http://www.dahd.nic.in/
http://www.fsi.gov.in/
http://www.nhb.gov.in/
http://www.mpsc.in/
http://www.maharashtra.gov.in/
http://agri.mah.nic.in/
http://www.oie.int/
http://www.apcr.org/
http://www.iaavr.org/
http://www.drlahanesunil.blogspot.com/
http://www.kemppl.net/
http://www.mahavet.nic.in/
http://www.google.co.in/
http://www.yashada.org/
http://www.indiaveterinarycommunity.com/
http://www.upsc.gov.in/
http://www.vci.nic.in/
http://www.fao.org/
http://www.vphasia.org/
http://www.ivri.nic.in/
http://www.icar.org.in/
http://www.kvkkard.com/
http://www.kvknndurbar.net/
http://www.kemppl.net/
http://www.iefa.net/
http://www.iahvb.co.in/
http://www.isid.org/
http://www.who.int/
http://www.promedmail.org/
http://www.cdc.gov/
http://www.nccs.res.in/
http://www.pdky.ac.in/
http://www.irctc.co.in/
http://www.yashraj.com/
http://www.gramgeeta.org/
http://www.mafsu.in/
http://www.aciar.gov.au/
http://www.cirg.res.in/
http://www.esakal.com/
http://www.lkmat.com/
http://www.indiaveterinarycommunity.com/
http://www.mahanews.gov.in/
http://www.co-operativeonnet.com/
http://www.ventribio.com/
http://www.venkys.com/
http://www.worldrabiesday.org/
http://www.worldvet.org/
http://www.vetsweb.com/
http://www.friendsofanimals.org/
http://www.dahd.nic.in/
http://www.steepgraph.com (PLM Software development company, Jagtap dairy, Himanshu Z)
http://www.nanddarshan.com/
http://www.iavmi.org/
http://www.nabard.org/
https://www.linkedin.com/
http://www.naukri.com
http://www.elitmus.com
http://www.elitmus.com
http://www.linkedin.com
www.nottingham.ac.uk
www.incometaxindiaefiling.gov.in
www.incometaxindiaefiling.gov.in
http://www.ammimah.org/
http://www.ncdc.nic.in/
http://www.nafed.india.com/
http://www.nddb.org/
http://www.dahd.nic.in/
http://www.fsi.gov.in/
http://www.nhb.gov.in/
http://www.mpsc.in/
http://www.maharashtra.gov.in/
http://agri.mah.nic.in/
http://www.oie.int/
http://www.apcr.org/
http://www.iaavr.org/
http://www.drlahanesunil.blogspot.com/
http://www.kemppl.net/
http://www.mahavet.nic.in/
http://www.google.co.in/
http://www.yashada.org/
http://www.indiaveterinarycommunity.com/
http://www.upsc.gov.in/
http://www.vci.nic.in/
http://www.fao.org/
http://www.vphasia.org/
http://www.ivri.nic.in/
http://www.icar.org.in/
http://www.kvkkard.com/
http://www.kvknndurbar.net/
http://www.kemppl.net/
http://www.iefa.net/
http://www.iahvb.co.in/
http://www.isid.org/
http://www.who.int/
http://www.promedmail.org/
http://www.cdc.gov/
http://www.nccs.res.in/
http://www.pdky.ac.in/
http://www.irctc.co.in/
http://www.yashraj.com/
http://www.gramgeeta.org/
http://www.mafsu.in/
http://www.aciar.gov.au/
http://www.cirg.res.in/
http://www.esakal.com/
http://www.lkmat.com/
http://www.indiaveterinarycommunity.com/
http://www.mahanews.gov.in/
http://www.co-operativeonnet.com/
http://www.ventribio.com/
http://www.venkys.com/
http://www.worldrabiesday.org/
http://www.worldvet.org/
http://www.vetsweb.com/
http://www.friendsofanimals.org/
http://www.dahd.nic.in/
http://www.steepgraph.com (PLM Software development company, Jagtap dairy, Himanshu Z)
http://www.nanddarshan.com/
http://www.iavmi.org/
http://www.nabard.org/
https://www.linkedin.com/
http://www.naukri.com
http://www.elitmus.com
Sunday, December 7, 2008
WRDDL , Aundh,Pune-7 (M.S.), India
Friday, November 7, 2008
DR.P.Anbalagan, IAS, MuncipalCommissione , Nashik (M.S) India.
Monday, July 21, 2008
Sunday, July 20, 2008
GROUP PHOTO AT WRDDL ,PUNE.
Thursday, July 17, 2008
Joint commssioner of animal Husbandry, I.V.B.P.Aundh, Pune,(M.S.) INDIA.
MY OFFICE, Address
JOINT COMMSSIONER OF ANIMAL HUSBANDRY,I.V.B.P.Aundh,Pune (M.S.), INDIA.
(o) 020-25697962
fAX:- 020-25697962
EMAIL:-drkrshingal@gmail.com
JOINT COMMSSIONER OF ANIMAL HUSBANDRY,I.V.B.P.Aundh,Pune (M.S.), INDIA.
(o) 020-25697962
fAX:- 020-25697962
EMAIL:-drkrshingal@gmail.com
Wednesday, July 16, 2008
Subscribe to:
Posts (Atom)













